|
Addgene inc
g0345 pspax2 addgene ![]() G0345 Pspax2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pmd2+g+envelope+vector+dna/pMD2%2EG+(Plasmid+%2312259)/pmc07266008-1112-151-153 Average 98 stars, based on 1 article reviews
g0345 pspax2 addgene - by Bioz Stars,
2026-09
98/100 stars
|
Buy from Supplier |
|
Thermo Fisher
pmd2 g envelope vector dna ![]() Pmd2 G Envelope Vector Dna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pmd2+g+envelope+vector+dna/DNA/ppr0876213-272-21-42 Average 99 stars, based on 1 article reviews
pmd2 g envelope vector dna - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Addgene inc
pmd2 g vector dna ![]() Pmd2 G Vector Dna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pmd2+g+envelope+vector+dna/pRS420+(Plasmid+%2311259)/pmc09085742-164-34-37 Average 93 stars, based on 1 article reviews
pmd2 g vector dna - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp btn3a1 hs01063368 m1 ![]() Gene Exp Btn3a1 Hs01063368 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pmd2+g+envelope+vector+dna/Gene+Exp%2E+BTN3A1%2C+Hs01063368_m1/pm34260935-257-10-13 Average 86 stars, based on 1 article reviews
gene exp btn3a1 hs01063368 m1 - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Addgene inc
pmd2 g vectors ![]() Pmd2 G Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pmd2+g+envelope+vector+dna/pLKO%2E1+-+TRC+cloning+vector+(Plasmid+%2310878)/pm29496737-257-10-14 Average 96 stars, based on 1 article reviews
pmd2 g vectors - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Addgene inc
pmd2 g plasmids ![]() Pmd2 G Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pmd2+g+envelope+vector+dna/pMDLg%2FpRRE+(Plasmid+%2312251)/pmc05278765-218-10-15 Average 96 stars, based on 1 article reviews
pmd2 g plasmids - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Addgene inc
pmd2 g vsvg ![]() Pmd2 G Vsvg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pmd2+g+envelope+vector+dna/psPAX2+(Plasmid+%2312260)/pmc06629955-123-18-19 Average 98 stars, based on 1 article reviews
pmd2 g vsvg - by Bioz Stars,
2026-09
98/100 stars
|
Buy from Supplier |
|
OriGene
pmd2 g ![]() Pmd2 G, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pmd2+g+envelope+vector+dna/GPD2+(NM_001083112)+Human+Tagged+ORF+Clone/pm40425538-231-22-6 Average 93 stars, based on 1 article reviews
pmd2 g - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Mirus Bio
transit -293 ![]() Transit 293, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pmd2+g+envelope+vector+dna/TransIT+-293/custom%40mir-2700%4039658355 Average 97 stars, based on 1 article reviews
transit -293 - by Bioz Stars,
2026-09
97/100 stars
|
Buy from Supplier |
|
Kyfora Bio
pei max transfection reagent ![]() Pei Max Transfection Reagent, supplied by Kyfora Bio, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pmd2+g+envelope+vector+dna/PEI+MAX+Transfection+Reagent/custom%4024765-1%4042439431 Average 99 stars, based on 1 article reviews
pei max transfection reagent - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Addgene inc
packaging plasmid pmd2 g ![]() Packaging Plasmid Pmd2 G, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/pmd2+g+envelope+vector+dna/pS2513%C2%B7PHP+(Plasmid+%23122590)/ppr0862276-217-28-31 Average 94 stars, based on 1 article reviews
packaging plasmid pmd2 g - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell
Article Title: Endocrine-exocrine signaling drives obesity-associated pancreatic ductal adenocarcinoma
doi: 10.1016/j.cell.2020.03.062
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: Davis (University of Wisconsin) N/A Mouse: Kras LSL-G12D : B6.129S4- Kras tm4Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008179, RRID:IMSR_JAX:008179 Mouse: p53 KO/WT :129- Trp53 tm1Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:002080, RRID:IMSR_JAX:002080 Mouse: p53 R172H/WT : 129S-Trp53 tm2Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008652, RRID:IMSR_JAX:008652 Mouse: Kras LA2 :129S/Sv- Kras tm3Tyj /J Tyler Jacks lab (MIT) IMSR Cat# JAX:008185, RRID:IMSR_JAX:008185 Mouse: C57BL/6J : C57/B6 Jackson Laboratories IMSR Cat# JAX:000664, RRID:IMSR_JAX:000664 Oligonucleotides Leptin cDNA Reverse Koch Institute Swanson Biotechnology Center TCAGCATTCAGGGCTAACATCCAACT mLepR sgRNA Forward Keck Biotechnology Center at Yale CACCGTGAAAGCCACCAGACCTCGA mLepR sgRNA Reverse Keck Biotechnology Center at Yale AAACTCGAGGTCTGGTGGCTTTCAC mLepR Target Site Forward Keck Biotechnology Center at Yale GGTTCTCAGTGCACGCATTT mLepR Target Site Reverse Keck Biotechnology Center at Yale ACAACGATTTTCCTGGCATCT Leptin cDNA Forward Koch Institute Swanson Biotechnology Center ATGTGCTGGAGACCCCTGT Recombinant DNA lentiGuide-puro Addgene Cat# 52963 lentiCas9-blast Addgene Cat# 52962 pFBAAVCAGmcsBgHpa University of Iowa Viral Vector Core Cat#
Techniques: Virus, Plasmid Preparation, Generated, Transplantation Assay, Recombinant, DNA Extraction, Lysis, Extraction, Blocking Assay, Western Blot, Enzyme-linked Immunosorbent Assay, Cell Viability Assay, Reverse Transcription, Bicinchoninic Acid Protein Assay, Picogreen Assay, Derivative Assay, Software